Appendix SPTS SGL A-C
This is an appendix to: Seaports With Sea Level Change - 20Country: Argentina, Coastal Id: 860Seaport Data:List #Port LinkCoastline CodeWOD Zone1Mar del Plata AR MDQ86053052Buenos Aires AR...
View ArticleAppendix SPTS MULTI U-Z
This is an appendix to: Seaports With Sea Level Change - 20Country: United States, Coastal Id: 760Seaport Data:List #Port LinkCoastline CodeWOD Zone1Honolulu US HNL7607215Tide Gauge Data:List #Station...
View ArticleAppendix SPTS MULTI P-T
This is an appendix to: Seaports With Sea Level Change - 20Country: Panama, Coastal Id: 840Seaport Data:List #Port LinkCoastline CodeWOD Zone1Vacamonte PA VAC84070072Cristobal PA CTB8407007Tide Gauge...
View ArticleAppendix SPTS MULTI M-O
This is an appendix to: Seaports With Sea Level Change - 20Country: Malaysia, Coastal Id: 550Seaport Data:List #Port LinkCoastline CodeWOD Zone1Lumut MY LUM55010102Tanjung Pelepas Johor MY...
View ArticleAppendix SPTS MULTI H-L
This is an appendix to: Seaports With Sea Level Change - 20Country: India, Coastal Id: 500Seaport Data:List #Port LinkCoastline CodeWOD Zone1Cochin IN COK50010072Tuticorin IN TUT5001007Tide Gauge...
View ArticleAppendix SPTS MULTI D-G
This is an appendix to: Seaports With Sea Level Change - 20Country: France, Coastal Id: 190Seaport Data:List #Port LinkCoastline CodeWOD Zone1Dunkerque FR DKK19015002Boulogne Sur Mer FR BOL1901500Tide...
View ArticleAppendix SPTS MULTI A-C
This is an appendix to: Seaports With Sea Level Change - 20Country: Canada, Coastal Id: 822Seaport Data:List #Port LinkCoastline CodeWOD Zone1Nanaimo CA NNO82274122Vancouver CA VAN82274123Alberni CM...
View ArticleClik here to view.
Seaports With Sea Level Change - 20
Any port in a stormThe PSMSL updated their database, so the following menu is based upon that and other updated data:(HTML) SingleCoastline Countries(HTML) MultiCoastline CountriesCoastline...
View ArticleClik here to view.
The Doll As Metaphor - 3
Fig. 1 Close up of a virus brainThe word 'accept' may be used when there is only one item offered to us, however, when there is a list of items we have to 'select' or 'choose' an item from two or more...
View ArticleDNA
Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (DNA nomenclature)ORIGIN 1 attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct 61 gttctctaaa cgaactttaa...
View ArticleRNA
Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (RNA nomenclature)ORIGIN 1 auuaaagguu uauaccuucc cagguaacaa accaaccaac uuucgaucuc uuguagaucu 61 guucucuaaa cgaacuuuaa...
View ArticleClik here to view.
It's In The GenBank - 3
Banks R BanksWhat should be in the GenBank (What is GenBank)?In the previous post of this series I utilized a GenBank GBFF file concerning the genome of "the mother of all SARS-CoV-2 viruses" for...
View ArticleClik here to view.
The Doll As Metaphor - 4
Proton induced RNA mutationI. BackgroundI have tried to stimulate biologists/virologists into taking a look at the haphazard way RNA is depicted in major government databases (such as GenBank) to no...
View ArticleClik here to view.
Quantum Biology
Close up of a virus brain?I. BackgroundThe better part of a decade ago Dredd Blog was complaining about a non-existent science called "Abiology" that should exist (Weekend Rebel Science Excursion - 27,...
View ArticleClik here to view.
Quantum Biology - 2
Close up of a virus brain?I. BackgroundIn a previous post I wrote that in a future post I would "do the math" related to the proton tunneling thingy (The Doll As Metaphor - 4). Doing even more...
View ArticleAppendix QB-3
This is an appendix to: Quantum Biology - 3Gene list:gene 1:gtttatgtagcttacctcctcaaagcaatacactgaaaatgtttagacgggctcacatcaccccataaacgene...
View ArticleClik here to view.
Quantum Biology - 3
DNA is not aliveI. BackgroundThe GenBank, which stores microbial and viral DNA/RNA (It's In The GenBank, 2, 3), also stores human DNA (Homo sapiens mitochondrion, complete genome).Today's appendix...
View ArticleClik here to view.
On The Origin Of The Home Of COVID-19 - 28
Yeti transmits SARS-CoV-2I. Yeti Did ItOne of the tenets of propaganda is to keep repeating something until is sinks into the minds of the targeted audience.Likewise, that is also a way to counter...
View ArticleClik here to view.
Quantum Biology - 4
Fig. 1Transcription: DNA~>mRNAIn this and other Dredd Blog series the subject of "quantum origins" has been contemplated.Those origins are hypothesized to have taken place over a span of time...
View ArticleAppendix HMCITTL
This is an appendix to: How Microbes Communicate In The Tiniest Language - 2To search for the GenBank data in the following table:1) choose a human or microbe in the table below2) copy its "GenBank...
View Article