Quantcast
Channel: Dredd Blog
Browsing all 3570 articles
Browse latest View live

Appendix SPTS SGL A-C

This is an appendix to: Seaports With Sea Level Change - 20Country: Argentina, Coastal Id: 860Seaport Data:List #Port LinkCoastline CodeWOD Zone1Mar del Plata AR MDQ86053052Buenos Aires AR...

View Article


Appendix SPTS MULTI U-Z

This is an appendix to: Seaports With Sea Level Change - 20Country: United States, Coastal Id: 760Seaport Data:List #Port LinkCoastline CodeWOD Zone1Honolulu US HNL7607215Tide Gauge Data:List #Station...

View Article


Appendix SPTS MULTI P-T

This is an appendix to: Seaports With Sea Level Change - 20Country: Panama, Coastal Id: 840Seaport Data:List #Port LinkCoastline CodeWOD Zone1Vacamonte PA VAC84070072Cristobal PA CTB8407007Tide Gauge...

View Article

Appendix SPTS MULTI M-O

This is an appendix to: Seaports With Sea Level Change - 20Country: Malaysia, Coastal Id: 550Seaport Data:List #Port LinkCoastline CodeWOD Zone1Lumut MY LUM55010102Tanjung Pelepas Johor MY...

View Article

Appendix SPTS MULTI H-L

This is an appendix to: Seaports With Sea Level Change - 20Country: India, Coastal Id: 500Seaport Data:List #Port LinkCoastline CodeWOD Zone1Cochin IN COK50010072Tuticorin IN TUT5001007Tide Gauge...

View Article


Appendix SPTS MULTI D-G

This is an appendix to: Seaports With Sea Level Change - 20Country: France, Coastal Id: 190Seaport Data:List #Port LinkCoastline CodeWOD Zone1Dunkerque FR DKK19015002Boulogne Sur Mer FR BOL1901500Tide...

View Article

Appendix SPTS MULTI A-C

This is an appendix to: Seaports With Sea Level Change - 20Country: Canada, Coastal Id: 822Seaport Data:List #Port LinkCoastline CodeWOD Zone1Nanaimo CA NNO82274122Vancouver CA VAN82274123Alberni CM...

View Article

Image may be NSFW.
Clik here to view.

Seaports With Sea Level Change - 20

Any port in a stormThe PSMSL updated their database, so the following menu is based upon that and other updated data:(HTML) SingleCoastline Countries(HTML) MultiCoastline CountriesCoastline...

View Article


Image may be NSFW.
Clik here to view.

The Doll As Metaphor - 3

Fig. 1 Close up of a virus brainThe word 'accept' may be used when there is only one item offered to us, however, when there is a list of items we have to 'select' or 'choose' an item from two or more...

View Article


DNA

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (DNA nomenclature)ORIGIN 1 attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct 61 gttctctaaa cgaactttaa...

View Article

RNA

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (RNA nomenclature)ORIGIN 1 auuaaagguu uauaccuucc cagguaacaa accaaccaac uuucgaucuc uuguagaucu 61 guucucuaaa cgaacuuuaa...

View Article

Image may be NSFW.
Clik here to view.

It's In The GenBank - 3

Banks R BanksWhat should be in the GenBank (What is GenBank)?In the previous post of this series I utilized a GenBank GBFF file concerning the genome of "the mother of all SARS-CoV-2 viruses" for...

View Article

Image may be NSFW.
Clik here to view.

The Doll As Metaphor - 4

Proton induced RNA mutationI. BackgroundI have tried to stimulate biologists/virologists into taking a look at the haphazard way RNA is depicted in major government databases (such as GenBank) to no...

View Article


Image may be NSFW.
Clik here to view.

Quantum Biology

Close up of a virus brain?I. BackgroundThe better part of a decade ago Dredd Blog was complaining about a non-existent science called "Abiology" that should exist (Weekend Rebel Science Excursion - 27,...

View Article

Image may be NSFW.
Clik here to view.

Quantum Biology - 2

Close up of a virus brain?I. BackgroundIn a previous post I wrote that in a future post I would "do the math" related to the proton tunneling thingy (The Doll As Metaphor - 4). Doing even more...

View Article


Appendix QB-3

This is an appendix to: Quantum Biology - 3Gene list:gene 1:gtttatgtagcttacctcctcaaagcaatacactgaaaatgtttagacgggctcacatcaccccataaacgene...

View Article

Image may be NSFW.
Clik here to view.

Quantum Biology - 3

DNA is not aliveI. BackgroundThe GenBank, which stores microbial and viral DNA/RNA (It's In The GenBank, 2, 3), also stores human DNA (Homo sapiens mitochondrion, complete genome).Today's appendix...

View Article


Image may be NSFW.
Clik here to view.

On The Origin Of The Home Of COVID-19 - 28

Yeti transmits SARS-CoV-2I. Yeti Did ItOne of the tenets of propaganda is to keep repeating something until is sinks into the minds of the targeted audience.Likewise, that is also a way to counter...

View Article

Image may be NSFW.
Clik here to view.

Quantum Biology - 4

Fig. 1Transcription: DNA~>mRNAIn this and other Dredd Blog series the subject of "quantum origins" has been contemplated.Those origins are hypothesized to have taken place over a span of time...

View Article

Appendix HMCITTL

This is an appendix to: How Microbes Communicate In The Tiniest Language - 2To search for the GenBank data in the following table:1) choose a human or microbe in the table below2) copy its "GenBank...

View Article
Browsing all 3570 articles
Browse latest View live